close

  
Name has mutational analysis has minimal aptamer application Article Image sequence
  •  
  •  
  • Class II (cAMP-d)
  • UAAAUCGACUUGUCGUAAACCCAUUCUUAUCGGCGUGCUCUACAGCCG
  •  
  •  
  • Class I (cAMP-a)
  • CCGACGCGUAAACGAAACGCACAUUCCCCCACAGGAUAUGUGCUCGG
  •  
  •  
  •  
  • UAAAUCGACUUGUCGCGUUGCAGGCUGCACCCCGUCCGUGGACCCCC
  •  
  •  
  • class II (cAMP-b)
  • UAAAACGACUUGUCGCGUGCUGCCCGCCUGUUCGCUUUCUGCACCCC
  •  
  •  
  • TGGTGGCTGTAGGTCAGCATCTGATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACAACG
  •  
  •  
  •  
  • GATTCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACAACG
  •  
  •  
  •  
  • CATGCGCCTTCCCCCTGTGGTTGGTGTCAGCCGGCCTGTG
  •  
  •  
  • CGGGATCCTAATGACCAAGGGTGGGAGGGAGGGGGTCATTAAATCCAGTATCAACACGCCACGATGGGATCACCGCCATGGGCCGTCCCACTGGTGCCAGTCGGATAGTGTTCCTATAGTGAGTCGTATTAGAA
  •  
  •  
  •  
  • CGGGATCCTAATGACCAAGGGTGGGAGGGAGGGGGTCATTAAATCCAG
  •  
  •  
  •  
  • ATGACCAAGGGTGGGAGGGAGGGGGTCAT
  •  
  •  
  •  
  • CCGGCCAAGGGTGGGAGGGAGGGGGCCGG
  •  
  •  
  •  
  • GGCCUAAAACAUACCAGAUUUCGAUCUGGAGAGGUGAAGAAUUCGACCACCUAGGCCGGU
  •  
  •  
  • GAGCUCAGCCUGUACUGCUGCUUAAAGCCUAAAACAUACCAGAUCGCCACCCGCGCUUUAAUCUGGAGAGGUGAAGAAUUCGACCACCUAGGCUGCACCACGG
  •  
  •  
  •  
  • CCGGCCAAGGGGTGGGGAGGGGAGGGGGGCCGG
  •  
  •  
  •  
  • CCGGCCAAAGGTGGGAGGGAGGGGGCCGG
  •  
  •  
  •  
  • CCGGCCAAGGGTGGGAGGGAGAGGGCCGG
  •  
  •  
  •  
  • CCGGCCAAGGGTGGGAGGGAAGGGGCCGG
  •  
  •  
  •  
  • CCGGCAAAGGGTGGGAGGGAGGGCGCCGG
  •  
  •  
  •  
  • CCGGCCTAGGGTGGGAGGGAGGGGGCCGG
  •  
  •  
  •  
  • CCGGCCATGGGTGGGAGGGAGGGGGCCGG
  •  
  •  
  •  
  • CCGGCCAAGGGAGGGAGGGAGGGGGCCGG
  •  
  •  
  •  
  • CCGGCCAAGGGTGGGTGGGAGGGGGCCGG
  •  
  •  
  •  
  • CCGGCCAAGGGTGGGAGGGTGGGGGCCGG
  •  
  •  
  •  
  • CCGGCCAGGGTGGGAGGGAGGGGGCCGG
  •  
  •  
  •  
  • CCGGCCGGGTGGGAGGGAGGGGGCCGG
  •  
  •  
  •  
  • CCGGCCAAGGGTGGGAGGGAGGGAGGCCGG
  •  
  •  
  •  
  • CCGGCCAAGGTGGAGGAGGGGCCGG
  •  
  •  
  •  
  • CCGGCCAAGGGTGGAAGGGAGGGGGCCGG
  •  
  •  
  •  
  • CCGGCCAAGGGTGGGAAGGAGGGGGCCGG
  •  
  •  
  •  
  • CCGGCCAAGGGTGGGAGGGAGGAGGCCGG
  •  
  •  
  •  
  • TGGTGGCTGTAGGTCAGGGGTGAAACGGGTCCCGGAGCATCGGACAACG
  •  
  •  
  •  
  • TGGTGGCTGTAGGTCAGCAGTCCTAGATCGGGTGTGGCTGGCTTGGGAGCATCGGACAACG
  •  
  •  
  •  
  • TGGTGGCTGTAGGTCAGCACGATGGGGAAAGGGTCCCCCTGGGTTGGAGCATCGGACAACG
  •  
  •  
  •  
  • TGGTGGCTGTAGGTCAACTGTCCGTCGGGTTTAGGGTGGCGTTCGGGAGCATCGGACAACG
  •  
  •  
  •  
  • TGGTGGCTGTAGGTCATCAGTCCCGATCAGGTGTGGGTGGCATTGGGAGCATCGGACAACG
  •  
  •  
  •  
  • TGGTGGCTGTAGGTCACCAAATGCGACGGGGCCTGTTTTAATGGGGGAGCATCGGACAACG
  •  
  •  
  •  
  • TGGTGGCTGTAGGTCACGTACGGTGGGAACGGTTCCTCTTAGGGTGAGCATCGGACAACG
  •  
  •  
  •  
  • TGGTGGCTGTAGGTCACAGGTGGCAGATCGGGTGTGGGTGGCCTGGGAGCATCGGACAACG
  •  
  •  
  •  
  • TGGTGGCTGTAGGTCAACATGCGACTGAGGCTCGGTTTATTGAGGGGAGCATCGGACAACG
  •  
  •  
  •  
  • TGGTGGCTGTAGGTCACCTGACGATCGGGTGTGGGTTGGCTTGAGGGAGCATCGGACAACG
  •  
  •  
  •  
  • TGGTGGCTGTAGGTCACCTTGTAGATCGGGTGTGGTTTGGCGTAGGGAGCATCGGACAACG
  •  
  •  
  •  
  • TGGTGGCTGTAGGTCAGCAGTACGATCGGGGGTGGGTGGATGTAGGGAGCATCGGACAACG
  •  
  •  
  •  
  • GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACA
  •  
  •  
  •  
  • GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGG
  •  
  •  
  •  
  • GATCGGGTGTGGGTGGCGTAAAGGGAGCATCG
  •  
  •  
  •  
  • GATCGGGTGTGGGTGGCGTAAAGGGAGCATC
  •  
  •  
  •  
  • GATCGGGTGTGGGTGGCGTAAAGGGAGCAT
  •  
  •  
  •  
  • GATCGGGTGTGGGTGGCGTAAAGGGAG
  • true
  •  
  • GGGAAUUCCGCGUGUGCGCCGCGGAAGACGUUGGAAGGAUAGAUACCUACAACGGGGAAUAUAGAGGCCAGCACAUAGUGAGGCCCUCCUCCCAAGGUCCGUUCGGGAUCCUC
  •  
  •  
  •  
  • GGGAAUUCCGCGUGUGCUGGCGGGGAGAACUUACAUGGAUUAGAGAGUGGUGCUUCAUAAGAAGGACAACUGCGUUCCAGCCGCACCCCCCCCCCAGUCCGUUCGGGAUCCUC
  •  
  •  
  •  
  • GGGAAUUCCGCGUGUGCGCCGCGGAAGACGUUGGAAGGAUAGAUACCUACAACGGGGAAUAUAGAGGCCAGCACAUAGUGAGGCCCUCCUCCC
  •  
  •  
  •  
  • GATCGGGTGTGGGTGGCGTAAAGG
  •  
  •  
  •  
  • GATCGGGTGTCGGTGGCGTAAAGGGAGCATCGGACAACG
  •  
  •  
  •  
  • ATCGGGTGTGGGTGGCGTAAAGGGAGCATCGG
  •  
  •  
  •  
  • TCGGGTGTGGGTGGCGTAAAGGGAGCATCGG
  •  
  •  
  •  
  • ATCGGGTGTGGGTGGCGTAAAG
  •  
  •  
  •  
  • GCGGGGTTGGGCGGGTGGGTTCGCTGGGCAGGGGGCGAGTG
  •  
  •  
  •  
  • TAGCGGGTGTGGTGGGTGGGGGAGGCATGGTTTTTGGTAA
  •  
  •  
  •  
  • GTCAAGGTGGGTGGGTGGGGTTGGTTGTTGTTTTGA
  •  
  •  
  •  
  • TATGAACCAAGGGAGGGGCAGGGCGGGTAGGGTTAATAACGGATTCCGAGCGCCCAGCTC
next

Comments

Hide